| mod ID | m6A_site_480479 | mod Site | chr2:74834351-74834352:+ | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
GGACACGTCGCCAGGAGAGAACTGAGGCGCCTTCTAGCAGT |
||||||||
| Motif Score | 3.37338095238095 | ||||||||||
| RNA Structure Motif |
((((..(((.......))).))))....... |
MFE | -6.40 | ||||||||
| Support Dataset Num | 15 | Support sub-Dataset Num | 43 | ||||||||
| Support Dataset List | |||||||||||
| Support sub-Dataset List |
GSM2739502, GSM2739503, GSM2739522, GSM2739523, GSM2739535, GSM2987447, GSM2987449, GSM3083806, GSM3083810, GSM3396437, GSM3396438, GSM3582048, GSM3582049, GSM928401, GSM1135020, GSM1135021, GSM1272364, GSM2010454, GSM2010456, GSM2283210, GSM2283211, GSM2283212, GSM2324298, GSM2324310, GSM2332988, GSM2417477, GSM2417478, GSM2417479, GSM2460356, GSM2460360, GSM2754211, GSM2754213, GSM2754214, GSM2754216, GSM2754220, GSM2754226, GSM2754235, GSM2754237, GSM2754238, GSM2754244, GSM2754246, GSM2564019, GSM2564022 |
||||||||||
| Cell/Tissue List |
HeLa, HepG2, HEK293T, H1B, MM6, Jurkat, peripheral-blood, HEK293A-TOA, TIME, TREX, iSLK, MSC, NB4 |
||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | ||||||||||
| Transcript ID List | ENST00000290573.6 | ||||||||||
| Transcript Detail |
|
||||||||||
| Conserved Sites | rheMac8:m6A_site_16093;rn6:m6A_site_73321 | ||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||
| snoRNA Guide Detail | na | ||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||
| Writer Catalysis Detail | na | ||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1