RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_48250

mod Site

chr1:119727133-119727134:+

mod Type

m6A

Sequence

CTGGAACCCTGTGATGTGGGACTTTCTGCAGCAATTTTGGG

Motif Score

4.06504166666667

RNA Structure Motif

.(((........)))................

MFE

-4.30

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE110320, GSE112795, GSE87190, GSE93911, GSE97408

Support sub-Dataset List

GSM2739503, GSM2991399, GSM2991400, GSM2987447, GSM3083810, GSM2324292, GSM2324298, GSM2324308, GSM2324310, GSM2464909, GSM2564019

Cell/Tissue List

HeLa, HepG2, peripheral-blood, endometrial, NB4

Seq Type List

m6A-seq

Transcript ID List

ENST00000641074.1,ENST00000641314.1,ENST00000369407.3,ENST00000641597.1,ENST00000641247.1,ENST00000641375.1,ENST00000641455.1,ENST00000641947.1,ENST00000641371.1,ENST00000641023.1,ENST00000641570.1,ENST00000641115.1,ENST00000369409.9,ENST00000642021.1,ENST00000641491.1,ENST00000641573.1,ENST00000641587.1,ENST00000641213.1,ENST00000641847.1,ENST00000641756.1,ENST00000641927.1,ENST00000493622.5,ENST00000641891.1,ENST00000462324.2,ENST00000641811.1,ENST00000641272.1

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000641074.1	ENSG00000092621.12	PHGDH	protein_coding	intron-5
ENST00000641314.1	ENSG00000092621.12	PHGDH	processed_transcript	intron-5
ENST00000369407.3	ENSG00000092621.12	PHGDH	retained_intron	intron-4
ENST00000641597.1	ENSG00000092621.12	PHGDH	protein_coding	intron-8
ENST00000641247.1	ENSG00000092621.12	PHGDH	nonsense_mediated_decay	intron-5
ENST00000641375.1	ENSG00000092621.12	PHGDH	nonsense_mediated_decay	intron-7
ENST00000641455.1	ENSG00000092621.12	PHGDH	processed_transcript	intron-1
ENST00000641947.1	ENSG00000092621.12	PHGDH	protein_coding	intron-5
ENST00000641371.1	ENSG00000092621.12	PHGDH	nonsense_mediated_decay	intron-5
ENST00000641023.1	ENSG00000092621.12	PHGDH	protein_coding	intron-5
ENST00000641570.1	ENSG00000092621.12	PHGDH	nonsense_mediated_decay	intron-6
ENST00000641115.1	ENSG00000092621.12	PHGDH	protein_coding	intron-5
ENST00000369409.9	ENSG00000092621.12	PHGDH	protein_coding	intron-5
ENST00000642021.1	ENSG00000092621.12	PHGDH	retained_intron	intron-5
ENST00000641491.1	ENSG00000092621.12	PHGDH	nonsense_mediated_decay	intron-6
ENST00000641573.1	ENSG00000092621.12	PHGDH	retained_intron	exon-5
ENST00000641587.1	ENSG00000092621.12	PHGDH	nonsense_mediated_decay	intron-5
ENST00000641213.1	ENSG00000092621.12	PHGDH	nonsense_mediated_decay	intron-6
ENST00000641847.1	ENSG00000092621.12	PHGDH	retained_intron	exon-2
ENST00000641756.1	ENSG00000092621.12	PHGDH	nonsense_mediated_decay	intron-8
ENST00000641927.1	ENSG00000092621.12	PHGDH	processed_transcript	intron-5
ENST00000493622.5	ENSG00000092621.12	PHGDH	protein_coding	intron-6
ENST00000641891.1	ENSG00000092621.12	PHGDH	nonsense_mediated_decay	intron-7
ENST00000462324.2	ENSG00000092621.12	PHGDH	processed_transcript	intron-5
ENST00000641811.1	ENSG00000092621.12	PHGDH	protein_coding	intron-4
ENST00000641272.1	ENSG00000092621.12	PHGDH	protein_coding	intron-4

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

29507755, 3086759, 31061416, 29249359, 30154548, 29290617

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.