RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_48260

mod Site

chr1:119737234-119737235:+

mod Type

m6A

Sequence

AATTGCTGTTCAGTTCGTGGACATGGTGAAGGGGAAATCTC

Motif Score

3.64304761904762

RNA Structure Motif

.((((((.....)))))).............

MFE

-4.90

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE110320, GSE129842, GSE87516

Support sub-Dataset List

GSM2991399, GSM2991400, GSM2987447, GSE129842, GSM2332990

Cell/Tissue List

HeLa, HepG2, hESC-HEK293T

Seq Type List

m6A-seq,MAZTER-seq

Transcript ID List

ENST00000641597.1,ENST00000642021.1,ENST00000641756.1,ENST00000369409.9,ENST00000641939.1,ENST00000641891.1,ENST00000369407.3,ENST00000641115.1,ENST00000641947.1,ENST00000641213.1,ENST00000641927.1,ENST00000641811.1,ENST00000641375.1,ENST00000641314.1,ENST00000641074.1,ENST00000641023.1

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000641597.1	ENSG00000092621.12	PHGDH	protein_coding	cds-11
ENST00000642021.1	ENSG00000092621.12	PHGDH	retained_intron	exon-8
ENST00000641756.1	ENSG00000092621.12	PHGDH	nonsense_mediated_decay	utr3-11
ENST00000369409.9	ENSG00000092621.12	PHGDH	protein_coding	cds-8
ENST00000641939.1	ENSG00000092621.12	PHGDH	processed_transcript	exon-1
ENST00000641891.1	ENSG00000092621.12	PHGDH	nonsense_mediated_decay	utr3-10
ENST00000369407.3	ENSG00000092621.12	PHGDH	retained_intron	exon-7
ENST00000641115.1	ENSG00000092621.12	PHGDH	protein_coding	cds-8
ENST00000641947.1	ENSG00000092621.12	PHGDH	protein_coding	cds-8
ENST00000641213.1	ENSG00000092621.12	PHGDH	nonsense_mediated_decay	utr3-9
ENST00000641927.1	ENSG00000092621.12	PHGDH	processed_transcript	exon-8
ENST00000641811.1	ENSG00000092621.12	PHGDH	protein_coding	cds-7
ENST00000641375.1	ENSG00000092621.12	PHGDH	nonsense_mediated_decay	utr3-10
ENST00000641314.1	ENSG00000092621.12	PHGDH	processed_transcript	exon-8
ENST00000641074.1	ENSG00000092621.12	PHGDH	protein_coding	cds-8
ENST00000641023.1	ENSG00000092621.12	PHGDH	protein_coding	cds-8

Conserved Sites

susScr11:m6A_site_93375

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

29507755, 3086759, 31257032, 27773536

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.