RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_488726

mod Site

chr2:111429451-111429452:-

mod Type

m6A

Sequence

GTTCCAACTGCCCACTGTGGACTCTGAGGCCTCTGCATTTG

Motif Score

4.06504166666667

RNA Structure Motif

....(((((..(....)..)).)))......

MFE

-3.60

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE110320, GSE112795, GSE87190, GSE87516, GSE93676, GSE93911

Support sub-Dataset List

GSM2739506, GSM2739507, GSM2991403, GSM2987449, GSM3083805, GSM3083810, GSM2324292, GSM2324298, GSM2324308, GSM2324310, GSM2332990, GSM2754238, GSM2464931

Cell/Tissue List

HeLa, HepG2, peripheral-blood, HEK293T, iSLK, HEC-1-A

Seq Type List

m6A-seq,MeRIP-seq

Transcript ID List

ENST00000308604.5,ENST00000431385.5,ENST00000441075.1,ENST00000444301.5,ENST00000443467.5,ENST00000604981.5,ENST00000643766.1,ENST00000439362.5,ENST00000603310.5,ENST00000645030.1,ENST00000603827.1,ENST00000419736.5,ENST00000442293.5,ENST00000409569.2,ENST00000432818.5,ENST00000644013.1,ENST00000642191.1,ENST00000643013.1,ENST00000453478.1,ENST00000645051.1

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000308604.5	ENSG00000172965.15	MIR4435-2HG	lincRNA	exon-3
ENST00000431385.5	ENSG00000172965.15	MIR4435-2HG	lincRNA	intron-1
ENST00000441075.1	ENSG00000172965.15	MIR4435-2HG	lincRNA	exon-3
ENST00000444301.5	ENSG00000172965.15	MIR4435-2HG	lincRNA	intron-1
ENST00000443467.5	ENSG00000172965.15	MIR4435-2HG	lincRNA	intron-1
ENST00000604981.5	ENSG00000172965.15	MIR4435-2HG	lincRNA	exon-4
ENST00000643766.1	ENSG00000172965.15	MIR4435-2HG	lincRNA	exon-5
ENST00000439362.5	ENSG00000172965.15	MIR4435-2HG	lincRNA	intron-1
ENST00000603310.5	ENSG00000172965.15	MIR4435-2HG	lincRNA	exon-2
ENST00000645030.1	ENSG00000172965.15	MIR4435-2HG	lincRNA	intron-1
ENST00000603827.1	ENSG00000172965.15	MIR4435-2HG	lincRNA	exon-1
ENST00000419736.5	ENSG00000172965.15	MIR4435-2HG	lincRNA	exon-4
ENST00000442293.5	ENSG00000172965.15	MIR4435-2HG	lincRNA	exon-3
ENST00000409569.2	ENSG00000172965.15	MIR4435-2HG	lincRNA	exon-2
ENST00000432818.5	ENSG00000172965.15	MIR4435-2HG	lincRNA	intron-1
ENST00000644013.1	ENSG00000285016.1	AC017002.6	processed_transcript	exon-8
ENST00000642191.1	ENSG00000172965.15	MIR4435-2HG	lincRNA	intron-1
ENST00000643013.1	ENSG00000172965.15	MIR4435-2HG	lincRNA	intron-1
ENST00000453478.1	ENSG00000172965.15	MIR4435-2HG	lincRNA	intron-1
ENST00000645051.1	ENSG00000172965.15	MIR4435-2HG	lincRNA	intron-1

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

29507755, 3086759, 31061416, 29249359, 27773536, 29109479, 30154548

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.