RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_489808

mod Site

chr2:113227092-113227093:-

mod Type

m6A

Sequence

AAGTATTGGAGCAAGGTGGGACACAAGGAGCAAGAGGCATA

Motif Score

3.64304761904762

RNA Structure Motif

.....((....((.....))....)).....

MFE

-1.60

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE93676, GSE93911

Support sub-Dataset List

GSM2460345, GSM2460347, GSM2460350, GSM2754211, GSM2754213, GSM2754226, GSM2754235, GSM2754237, GSM2464903, GSM2464905, GSM2464907, GSM2464909, GSM2464911, GSM2464913, GSM2464915, GSM2464917, GSM2464919, GSM2464921, GSM2464927, GSM2464931

Cell/Tissue List

iSLK, TREX, endometrial, HEC-1-A

Seq Type List

MeRIP-seq,m6A-seq

Transcript ID List

ENST00000397647.7,ENST00000429538.8,ENST00000485840.1,ENST00000497038.6,ENST00000263334.9,ENST00000263335.11,ENST00000348715.9,ENST00000468980.3,ENST00000465084.1

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000397647.7	ENSG00000125618.17	PAX8	protein_coding	intron-7
ENST00000429538.8	ENSG00000125618.17	PAX8	protein_coding	intron-10
ENST00000485840.1	ENSG00000125618.17	PAX8	retained_intron	exon-3
ENST00000497038.6	ENSG00000125618.17	PAX8	protein_coding	intron-4
ENST00000263334.9	ENSG00000125618.17	PAX8	protein_coding	intron-10
ENST00000263335.11	ENSG00000125618.17	PAX8	protein_coding	intron-8
ENST00000348715.9	ENSG00000125618.17	PAX8	protein_coding	intron-10
ENST00000468980.3	ENSG00000125618.17	PAX8	protein_coding	intron-3
ENST00000465084.1	ENSG00000125618.17	PAX8	protein_coding	intron-2

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

29109479, 30154548

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.