RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_494847

mod Site

chr2:145151971-145151972:+

mod Type

m6A

Sequence

ATGCCCAGCTCAGTGGTTGGACAGAGAAGAAACTCCAAAGC

Motif Score

3.64304761904762

RNA Structure Motif

(((((....)))))....(((......))).

MFE

-4.20

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE125803, GSE76414, GSE83438, GSE93676

Support sub-Dataset List

GSM3582054, GSM2010454, GSM2203060, GSM2460348, GSM2460350, GSM2754214, GSM2754216, GSM2754235, GSM2754238, GSM2754240

Cell/Tissue List

A549, MM6, Huh7, iSLK

Seq Type List

MeRIP-seq,m6A-seq

Transcript ID List

ENST00000596747.5,ENST00000597893.5,ENST00000628794.2,ENST00000628136.2,ENST00000627757.2,ENST00000629613.2,ENST00000626411.2,ENST00000597670.5,ENST00000598659.5,ENST00000628180.2,ENST00000608432.5,ENST00000600064.5,ENST00000627545.2,ENST00000596589.5,ENST00000595686.5,ENST00000596230.5,ENST00000626325.2,ENST00000594626.5,ENST00000599072.5,ENST00000626239.2,ENST00000602108.5,ENST00000626133.2,ENST00000629631.2,ENST00000628688.2,ENST00000630651.2,ENST00000631271.2,ENST00000631075.2,ENST00000627051.2,ENST00000629585.2,ENST00000420472.1,ENST00000597173.5,ENST00000600679.5,ENST00000629460.2,ENST00000596540.5,ENST00000625887.2,ENST00000630451.2,ENST00000627675.2,ENST00000596034.5,ENST00000630122.2,ENST00000629185.2,ENST00000625651.2,ENST00000414195.6,ENST00000625362.2,ENST00000627195.2,ENST00000627991.2,ENST00000451478.5,ENST00000601578.5,ENST00000628237.2,ENST00000604253.5,ENST00000628775.2,ENST00000625557.1,ENST00000628985.2,ENST00000601277.5,ENST00000594471.5,ENST00000630709.2,ENST00000598248.5,ENST00000602041.5,ENST00000608652.5,ENST00000630691.2,ENST00000596970.5,ENST00000599187.5,ENST00000625671.2,ENST00000609705.5,ENST00000630246.2,ENST00000630959.2,rmsk_698308,ENST00000631167.2,ENST00000626952.1,ENST00000626197.2,ENST00000597469.5,ENST00000628057.2,ENST00000630732.2,ENST00000597655.5

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000596747.5	ENSG00000226674.10	TEX41	lincRNA	exon-3
ENST00000597893.5	ENSG00000226674.10	TEX41	lincRNA	intron-4
ENST00000628794.2	ENSG00000226674.10	TEX41	lincRNA	intron-2
ENST00000628136.2	ENSG00000226674.10	TEX41	lincRNA	intron-4
ENST00000627757.2	ENSG00000226674.10	TEX41	lincRNA	intron-4
ENST00000629613.2	ENSG00000226674.10	TEX41	lincRNA	intron-3
ENST00000626411.2	ENSG00000226674.10	TEX41	lincRNA	intron-3
ENST00000597670.5	ENSG00000226674.10	TEX41	lincRNA	intron-5
ENST00000598659.5	ENSG00000226674.10	TEX41	lincRNA	intron-5
ENST00000628180.2	ENSG00000226674.10	TEX41	lincRNA	intron-2
ENST00000608432.5	ENSG00000226674.10	TEX41	lincRNA	intron-1
ENST00000600064.5	ENSG00000226674.10	TEX41	lincRNA	intron-5
ENST00000627545.2	ENSG00000226674.10	TEX41	lincRNA	intron-1
ENST00000596589.5	ENSG00000226674.10	TEX41	lincRNA	intron-4
ENST00000595686.5	ENSG00000226674.10	TEX41	lincRNA	intron-4
ENST00000596230.5	ENSG00000226674.10	TEX41	lincRNA	intron-3
ENST00000626325.2	ENSG00000226674.10	TEX41	lincRNA	intron-3
ENST00000594626.5	ENSG00000226674.10	TEX41	lincRNA	intron-2
ENST00000599072.5	ENSG00000226674.10	TEX41	lincRNA	intron-4
ENST00000626239.2	ENSG00000226674.10	TEX41	lincRNA	intron-2
ENST00000602108.5	ENSG00000226674.10	TEX41	lincRNA	intron-2
ENST00000626133.2	ENSG00000226674.10	TEX41	lincRNA	intron-4
ENST00000629631.2	ENSG00000226674.10	TEX41	lincRNA	intron-3
ENST00000628688.2	ENSG00000226674.10	TEX41	lincRNA	intron-4
ENST00000630651.2	ENSG00000226674.10	TEX41	lincRNA	intron-5
ENST00000631271.2	ENSG00000226674.10	TEX41	lincRNA	intron-3
ENST00000631075.2	ENSG00000226674.10	TEX41	lincRNA	exon-4
ENST00000627051.2	ENSG00000226674.10	TEX41	lincRNA	intron-3
ENST00000629585.2	ENSG00000226674.10	TEX41	lincRNA	intron-2
ENST00000420472.1	ENSG00000226674.10	TEX41	lincRNA	intron-1
ENST00000597173.5	ENSG00000226674.10	TEX41	lincRNA	exon-2
ENST00000600679.5	ENSG00000226674.10	TEX41	lincRNA	intron-5
ENST00000629460.2	ENSG00000226674.10	TEX41	lincRNA	intron-2
ENST00000596540.5	ENSG00000226674.10	TEX41	lincRNA	intron-5
ENST00000625887.2	ENSG00000226674.10	TEX41	lincRNA	intron-3
ENST00000630451.2	ENSG00000226674.10	TEX41	lincRNA	intron-3
ENST00000627675.2	ENSG00000226674.10	TEX41	lincRNA	intron-4
ENST00000596034.5	ENSG00000226674.10	TEX41	lincRNA	intron-1
ENST00000630122.2	ENSG00000226674.10	TEX41	lincRNA	intron-2
ENST00000629185.2	ENSG00000226674.10	TEX41	lincRNA	intron-5
ENST00000625651.2	ENSG00000226674.10	TEX41	lincRNA	intron-4
ENST00000414195.6	ENSG00000226674.10	TEX41	lincRNA	intron-1
ENST00000625362.2	ENSG00000226674.10	TEX41	lincRNA	intron-4
ENST00000627195.2	ENSG00000226674.10	TEX41	lincRNA	intron-5
ENST00000627991.2	ENSG00000226674.10	TEX41	lincRNA	intron-3
ENST00000451478.5	ENSG00000226674.10	TEX41	lincRNA	intron-1
ENST00000601578.5	ENSG00000226674.10	TEX41	lincRNA	intron-4
ENST00000628237.2	ENSG00000226674.10	TEX41	lincRNA	intron-1
ENST00000604253.5	ENSG00000226674.10	TEX41	lincRNA	intron-1
ENST00000628775.2	ENSG00000226674.10	TEX41	lincRNA	intron-2
ENST00000625557.1	ENSG00000226674.10	TEX41	lincRNA	intron-1
ENST00000628985.2	ENSG00000226674.10	TEX41	lincRNA	intron-3
ENST00000601277.5	ENSG00000226674.10	TEX41	lincRNA	intron-4
ENST00000594471.5	ENSG00000226674.10	TEX41	lincRNA	intron-3
ENST00000630709.2	ENSG00000226674.10	TEX41	lincRNA	intron-5
ENST00000598248.5	ENSG00000226674.10	TEX41	lincRNA	intron-5
ENST00000602041.5	ENSG00000226674.10	TEX41	lincRNA	intron-2
ENST00000608652.5	ENSG00000226674.10	TEX41	lincRNA	intron-1
ENST00000630691.2	ENSG00000226674.10	TEX41	lincRNA	intron-4
ENST00000596970.5	ENSG00000226674.10	TEX41	lincRNA	intron-3
ENST00000599187.5	ENSG00000226674.10	TEX41	lincRNA	intron-6
ENST00000625671.2	ENSG00000226674.10	TEX41	lincRNA	intron-4
ENST00000609705.5	ENSG00000226674.10	TEX41	lincRNA	intron-1
ENST00000630246.2	ENSG00000226674.10	TEX41	lincRNA	intron-3
ENST00000630959.2	ENSG00000226674.10	TEX41	lincRNA	intron-1
rmsk_698308	rmsk_698308	HSMAR1	TcMar-Mariner	exon
ENST00000631167.2	ENSG00000226674.10	TEX41	lincRNA	intron-4
ENST00000626952.1	ENSG00000226674.10	TEX41	lincRNA	intron-2
ENST00000626197.2	ENSG00000226674.10	TEX41	lincRNA	intron-5
ENST00000597469.5	ENSG00000226674.10	TEX41	lincRNA	intron-4
ENST00000628057.2	ENSG00000226674.10	TEX41	lincRNA	intron-2
ENST00000630732.2	ENSG00000226674.10	TEX41	lincRNA	intron-4
ENST00000597655.5	ENSG00000226674.10	TEX41	lincRNA	intron-5

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

31597913, 28017614, 27773535, 29109479

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.