| mod ID | m6A_site_496253 | mod Site | chr2:156329931-156329932:- | |||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
TACCAAATGCCCCTGTCCGGACAGCAGTCCTCCATTAAGGT |
|||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.64304761904762 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
.............((((....))))...... |
MFE | -5.20 | |||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 10 | Support sub-Dataset Num | 29 | |||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739502, GSM2739503, GSM3396437, GSM3396438, GSM3582048, GSM3582049, GSM3582052, GSM3582053, GSM3582054, GSE129842, GSM1135020, GSM1135032, GSM1135033, GSM1828594, GSM1828596, GSM2203043, GSM2203047, GSM2203051, GSM2203055, GSM2203059, GSM2417477, GSM2417479, GSM2460348, GSM2460350, GSM2460354, GSM2464907, GSM2464913, GSM2464917, GSM2464919 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HEK293T, A549, hESC-HEK293T, CD8T, Huh7, HEK293A-TOA, iSLK, MSC, endometrial |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq,MAZTER-seq,m6A-CLIP/IP | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000429376.5,ENST00000424077.1,ENST00000409572.5,ENST00000406048.2,ENST00000421709.1,ENST00000409108.6,ENST00000417972.5,ENST00000417764.5,ENST00000426264.5,ENST00000339562.9 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_337485;panTro5:m6A_site_43089;rheMac8:m6A_site_13554;rn6:m6A_site_64584 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1