| mod ID | m6A_site_499587 | mod Site | chr2:172427879-172427880:+ | |||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CAACTTGGACACTCGGGAGGACAACGTGATCCGGAAATATG |
|||||||||||||||||||||||||||||||||
| Motif Score | 3.64304761904762 | |||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
(((((((...(.....)...))).))))... |
MFE | -5.70 | |||||||||||||||||||||||||||||||||
| Support Dataset Num | 13 | Support sub-Dataset Num | 44 | |||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739502, GSM2739503, GSM2739522, GSM2739523, GSM2739535, GSM2987447, GSM2987448, GSM2987449, GSM3083810, GSM3582046, GSM3582049, GSM3582052, GSM3582053, GSM3582054, GSE129842, GSM1166139, GSM2283212, GSM2283214, GSM2324292, GSM2332975, GSM2332977, GSM2332978, GSM2332985, GSM2332986, GSM2332987, GSM2332988, GSM2332989, GSM2332990, GSM2754213, GSM2754214, GSM2754222, GSM2754224, GSM2754237, GSM2754246, GSM2754248, GSM2464905, GSM2464911, GSM2464913, GSM2464915, GSM2464921, GSM2464923, GSM2464927, GSM2464931, GSM2483505 |
|||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HepG2, A549, hESC-HEK293T, U2OS, Jurkat, CD4T, peripheral-blood, GSC-11, iSLK, TIME, endometrial, HEC-1-A, GSCs |
|||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq,MAZTER-seq | |||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000409080.6,ENST00000264107.11,ENST00000409532.5,ENST00000458358.5,ENST00000412899.5,ENST00000442250.5 | |||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_340531;susScr11:m6A_site_48691 | |||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1