| mod ID | m6A_site_499667 | mod Site | chr2:172504685-172504686:+ | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
TAGCTGTCCCACATCACAAGACTATGCCATTGGGGTAGTTG |
|||||||||||||
| Motif Score | 3.31938095238095 | |||||||||||||||
| RNA Structure Motif |
.(((((.((..((......))..))))))). |
MFE | -3.60 | |||||||||||||
| Support Dataset Num | 14 | Support sub-Dataset Num | 47 | |||||||||||||
| Support Dataset List | ||||||||||||||||
| Support sub-Dataset List |
GSM2739506, GSM2739507, GSM2991403, GSM2987449, GSM3396437, GSM3396438, GSM3582046, GSM3582048, GSM3582049, GSM3582052, GSM3582053, GSM3582054, GSM928399, GSM928401, GSM908337, GSM1135032, GSM1135033, GSM1166139, GSM1166140, GSM1166141, GSM1166143, GSM1339407, GSM1339427, GSM1339429, GSM1982263, GSM2203047, GSM2203051, GSM2203052, GSM2283210, GSM2460347, GSM2460356, GSM2460358, GSM2460360, GSM2460362, GSM2754213, GSM2754222, GSM2754224, GSM2754226, GSM2754235, GSM2754237, GSM2754246, GSM2754248, GSM2464911, GSM2464915, GSM2464917, GSM2464919, GSM2464931 |
|||||||||||||||
| Cell/Tissue List |
HeLa, HepG2, HEK293T, A549, U2OS, fibroblasts, H1299, Huh7, Jurkat, iSLK, TIME, TREX, endometrial, HEC-1-A |
|||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | |||||||||||||||
| Transcript ID List | ENST00000264107.11,ENST00000409080.6 | |||||||||||||||
| Transcript Detail |
|
|||||||||||||||
| Conserved Sites | mm10:m6A_site_340573;rn6:m6A_site_64991 | |||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1