RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_500922

mod Site

chr2:176176659-176176660:-

mod Type

m6A

Sequence

GGACCAAAGTAATGCCAAGAACTCCCAGATGAAGAGGACCT

Motif Score

3.37338095238095

RNA Structure Motif

...............................

MFE

0.00

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE120229, GSE29714, GSE83438, GSE90914, GSE93676

Support sub-Dataset List

GSM3396437, GSM3396438, GSM928399, GSM2203063, GSM2203064, GSM2417477, GSM2417479, GSM2460356, GSM2460358

Cell/Tissue List

HEK293T, Huh7, HEK293A-TOA, TIME

Seq Type List

MeRIP-seq,m6A-seq

Transcript ID List

ENST00000546798.5,ENST00000447538.6,ENST00000413969.6,ENST00000417086.6,ENST00000416928.7,ENST00000456876.1,ENST00000643050.1,ENST00000436126.5,ENST00000547207.2,ENST00000552156.5,ENST00000642267.1,ENST00000644334.1,ENST00000452365.2,ENST00000549329.5,ENST00000425005.5,ENST00000645228.1

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000546798.5	ENSG00000224189.7	HAGLR	antisense	exon-3
ENST00000447538.6	ENSG00000224189.7	HAGLR	antisense	exon-3
ENST00000413969.6	ENSG00000224189.7	HAGLR	antisense	exon-3
ENST00000417086.6	ENSG00000224189.7	HAGLR	antisense	exon-5
ENST00000416928.7	ENSG00000224189.7	HAGLR	antisense	exon-3
ENST00000456876.1	ENSG00000224189.7	HAGLR	antisense	exon-2
ENST00000643050.1	ENSG00000224189.7	HAGLR	antisense	exon-3
ENST00000436126.5	ENSG00000224189.7	HAGLR	antisense	exon-4
ENST00000547207.2	ENSG00000224189.7	HAGLR	antisense	exon-2
ENST00000552156.5	ENSG00000224189.7	HAGLR	antisense	exon-4
ENST00000642267.1	ENSG00000224189.7	HAGLR	antisense	exon-4
ENST00000644334.1	ENSG00000224189.7	HAGLR	antisense	exon-3
ENST00000452365.2	ENSG00000224189.7	HAGLR	antisense	exon-5
ENST00000549329.5	ENSG00000224189.7	HAGLR	antisense	exon-4
ENST00000425005.5	ENSG00000224189.7	HAGLR	antisense	exon-5
ENST00000645228.1	ENSG00000224189.7	HAGLR	antisense	exon-5

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

22608085, 27773535, 28525753, 29109479

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.