| mod ID | m6A_site_501232 | mod Site | chr2:177263712-177263713:- | |||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
AGTGCGGGCGAGGGCAGTGGACTCTGAGGCCGGAGTCGGCG |
|||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 4.06504166666667 | |||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
..((....)).....((((((....)))))) |
MFE | -7.60 | |||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 11 | Support sub-Dataset Num | 28 | |||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739522, GSM2739523, GSM2739534, GSM2739535, GSM3083805, GSM3083806, GSM3083810, GSM3582046, GSM3582053, GSM1272358, GSM2283212, GSM2332975, GSM2332977, GSM2332978, GSM2332986, GSM2417479, GSM2460352, GSM2460360, GSM2754214, GSM2754216, GSM2754224, GSM2754226, GSM2754235, GSM2754240, GSM2754244, GSM2754246, GSM2464931, GSM2483505 |
|||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, A549, H1A, Jurkat, GSC-11, HEK293T, HEK293A-TOA, MSC, TREX, iSLK, TIME, HEC-1-A, GSCs |
|||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | |||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000462023.1,ENST00000588123.1,ENST00000586532.5,ENST00000464747.5,ENST00000430047.1,ENST00000421929.5,ENST00000397062.8,ENST00000397063.8 | |||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | na | |||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1