| mod ID | m6A_site_505562 | mod Site | chr2:199458547-199458548:- | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
GCGAGGCGGCCGCGCCCTGGACCCGCCACAAGGAGGAGGAC |
||||||||||||||||||||||||||||
| Motif Score | 3.62240476190476 | ||||||||||||||||||||||||||||||
| RNA Structure Motif |
(((((((.....)))..)))).......... |
MFE | -6.30 | ||||||||||||||||||||||||||||
| Support Dataset Num | 13 | Support sub-Dataset Num | 42 | ||||||||||||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739523, GSM2739534, GSM2739535, GSM3083810, GSM3582046, GSM3582047, GSM3582053, GSM3582054, GSM908337, GSM2010456, GSM2283210, GSM2283211, GSM2283213, GSM2332975, GSM2332977, GSM2332978, GSM2332985, GSM2332986, GSM2332987, GSM2332988, GSM2332989, GSM2332990, GSM2417477, GSM2417478, GSM2417479, GSM2460352, GSM2754211, GSM2754214, GSM2754216, GSM2754220, GSM2754222, GSM2754224, GSM2754237, GSM2754238, GSM2754240, GSM2754244, GSM2754246, GSM2754248, GSM2464931, GSM2483505, GSM2564019, GSM2564022 |
||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, A549, HepG2, MM6, Jurkat, GSC-11, HEK293T, HEK293A-TOA, MSC, iSLK, TIME, HEC-1-A, GSCs, NB4 |
||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | ||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000457245.5,ENST00000463386.1,ENST00000260926.9,ENST00000614512.4,ENST00000443023.5 | ||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_9106 | ||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1