| mod ID | m6A_site_506607 | mod Site | chr2:201286493-201286494:+ | |||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CACCATCCTGACTGAAGTGAACTATGAAGTAAGCAACAAGG |
|||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.37338095238095 | |||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
...........((..(((....)))..)).. |
MFE | -1.80 | |||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 14 | Support sub-Dataset Num | 29 | |||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2987447, GSM2987449, GSM3396437, GSM3396438, GSM3582052, GSM3582053, GSM3582054, GSM928399, GSM908337, GSM2010454, GSM2203060, GSM2283211, GSM2324292, GSM2324298, GSM2324308, GSM2324310, GSM2332975, GSM2417478, GSM2460345, GSM2460347, GSM2460348, GSM2460350, GSM2754211, GSM2754214, GSM2754216, GSM2464911, GSM2464919, GSM2564019, GSM2564022 |
|||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HepG2, HEK293T, A549, MM6, Huh7, Jurkat, peripheral-blood, GSC-11, HEK293A-TOA, iSLK, endometrial, NB4 |
|||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | |||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000264274.13,ENST00000432109.6,ENST00000264275.9,ENST00000392263.6,ENST00000339403.6,ENST00000358485.8,ENST00000323492.11,ENST00000444430.2 | |||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_9743;panTro5:m6A_site_43882;rn6:m6A_site_104501 | |||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1