RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_519051

mod Site

chr2:241651927-241651928:+

mod Type

m6A

Sequence

GGAGCTGGAAGGAGATGGGGACTGGTTCTCAGCCTTGCCTC

Motif Score

4.06504166666667

RNA Structure Motif

...((((...((((((....)))))).))))

MFE

-6.20

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE74016, GSE87190

Support sub-Dataset List

GSM1908206, GSM2324298, GSM2324308, GSM2324310

Cell/Tissue List

MT4, peripheral-blood

Seq Type List

MeRIP-seq,m6A-seq

Transcript ID List

ENST00000475195.5,ENST00000483778.5,ENST00000430617.6,ENST00000402096.5,ENST00000468018.5,ENST00000344376.9,ENST00000405546.7,ENST00000415107.5,ENST00000479554.5,ENST00000400771.7,ENST00000482507.5,ENST00000404914.8,ENST00000494465.5,ENST00000465399.5,ENST00000419606.5,ENST00000625810.2,ENST00000425239.5,ENST00000491867.5,ENST00000400772.6,ENST00000493618.5

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000475195.5	ENSG00000168397.17	ATG4B	retained_intron	intron-3
ENST00000483778.5	ENSG00000168397.17	ATG4B	retained_intron	intron-3
ENST00000430617.6	ENSG00000168397.17	ATG4B	protein_coding	intron-3
ENST00000402096.5	ENSG00000168397.17	ATG4B	protein_coding	intron-3
ENST00000468018.5	ENSG00000168397.17	ATG4B	retained_intron	intron-2
ENST00000344376.9	ENSG00000168397.17	ATG4B	nonsense_mediated_decay	intron-2
ENST00000405546.7	ENSG00000168397.17	ATG4B	protein_coding	intron-3
ENST00000415107.5	ENSG00000168397.17	ATG4B	nonsense_mediated_decay	cds-4
ENST00000479554.5	ENSG00000168397.17	ATG4B	retained_intron	exon-4
ENST00000400771.7	ENSG00000168397.17	ATG4B	protein_coding	intron-3
ENST00000482507.5	ENSG00000168397.17	ATG4B	retained_intron	intron-3
ENST00000404914.8	ENSG00000168397.17	ATG4B	protein_coding	intron-3
ENST00000494465.5	ENSG00000168397.17	ATG4B	retained_intron	intron-3
ENST00000465399.5	ENSG00000168397.17	ATG4B	retained_intron	intron-3
ENST00000419606.5	ENSG00000168397.17	ATG4B	protein_coding	intron-4
ENST00000625810.2	ENSG00000168397.17	ATG4B	protein_coding	cds-4
ENST00000425239.5	ENSG00000168397.17	ATG4B	protein_coding	intron-3
ENST00000491867.5	ENSG00000168397.17	ATG4B	processed_transcript	exon-4
ENST00000400772.6	ENSG00000168397.17	ATG4B	nonsense_mediated_decay	cds-4
ENST00000493618.5	ENSG00000168397.17	ATG4B	retained_intron	intron-2

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

27572442, 29249359

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.