| mod ID | m6A_site_519541 | mod Site | chr20:397082-397083:+ | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
TCAGGCACCTCTGTCCAAGGACAATCCCTTTCACAAACAAA |
||||||||
| Motif Score | 3.64304761904762 | ||||||||||
| RNA Structure Motif |
......(((..((((......))))..))). |
MFE | -4.40 | ||||||||
| Support Dataset Num | 21 | Support sub-Dataset Num | 58 | ||||||||
| Support Dataset List | |||||||||||
| Support sub-Dataset List |
GSM2987449, GSM3396437, GSM3396438, GSM3582046, GSM3582047, GSM3582048, GSM3582049, GSM3582052, GSM3582053, GSM3582054, GSE129842, GSM928399, GSM908335, GSM908337, GSM1135020, GSM1135021, GSM1135032, GSM1135033, GSM1166144, GSM1272360, GSM1272368, GSM1339395, GSM1339425, GSM1339429, GSM1339439, GSM1594131, GSM1828596, GSM1982257, GSM1982263, GSM2010454, GSM2010456, GSM2203047, GSM2203048, GSM2203052, GSM2203056, GSM2203060, GSM2203064, GSM2283214, GSM2417477, GSM2417478, GSM2417479, GSM2460345, GSM2460347, GSM2460352, GSM2460354, GSM2460356, GSM2460358, GSM2460360, GSM2754213, GSM2754214, GSM2754216, GSM2754222, GSM2754224, GSM2754226, GSM2754246, GSM2754248, GSM2464931, GSM2564019 |
||||||||||
| Cell/Tissue List |
HepG2, HEK293T, HeLa, A549, hESC-HEK293T, U2OS, H1B, hESCs, GM12878, H1299, MM6, Huh7, CD4T, HEK293A-TOA, iSLK, MSC, TIME, TREX, HEC-1-A, NB4 |
||||||||||
| Seq Type List | m6A-seq,MeRIP-seq,MAZTER-seq,m6A-CLIP/IP | ||||||||||
| Transcript ID List | ENST00000217233.8 | ||||||||||
| Transcript Detail |
|
||||||||||
| Conserved Sites | mm10:m6A_site_361981;rn6:m6A_site_68454 | ||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||
| snoRNA Guide Detail | na | ||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||
| Writer Catalysis Detail | na | ||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1