Details of RNA Modification Site of hg38
mod ID m6A_site_520377 mod Site chr20:1937837-1937838:+
mod Type m6A Sequence CAACCTGGGAAGTGGCCAGAACTGCCTGGGGTCCAAGAACT
Motif Score 3.37338095238095
RNA Structure Motif ..(((.....((((......))))..)))..
 MFE -7.90
Support Dataset Num 20 Support sub-Dataset Num 97
Support Dataset List
Support sub-Dataset List

GSM2739535, GSM2987447, GSM2987449, GSM3396437, GSM3396438, GSM3582046, GSM3582047, GSM3582048, GSM3582049, GSM3582052, GSM3582053, GSM3582054, GSM1166139, GSM1166140, GSM1166141, GSM1166142, GSM1166143, GSM1166144, GSM1272358, GSM1272360, GSM1272362, GSM1272364, GSM1272366, GSM1272368, GSM1339393, GSM1339395, GSM1339401, GSM1339403, GSM1339405, GSM1339407, GSM1339425, GSM1339427, GSM1339429, GSM1339439, GSM1594131, GSM1982257, GSM2010454, GSM2010456, GSM2203043, GSM2203044, GSM2203047, GSM2203055, GSM2203056, GSM2203059, GSM2203060, GSM2203064, GSM2283212, GSM2283214, GSM2283215, GSM2324292, GSM2324298, GSM2324308, GSM2324310, GSM2332975, GSM2332977, GSM2332978, GSM2417477, GSM2417478, GSM2417479, GSM2460345, GSM2460347, GSM2460348, GSM2460350, GSM2460352, GSM2460354, GSM2460356, GSM2460358, GSM2754211, GSM2754213, GSM2754214, GSM2754216, GSM2754220, GSM2754222, GSM2754224, GSM2754235, GSM2754237, GSM2754238, GSM2754240, GSM2754244, GSM2754246, GSM2754248, GSM2464905, GSM2464907, GSM2464909, GSM2464911, GSM2464913, GSM2464915, GSM2464917, GSM2464919, GSM2464921, GSM2464923, GSM2464927, GSM2464931, GSM2483505, GSM2564019, GSM2564022, GSM2602070
Cell/Tissue List

HeLa, HepG2, HEK293T, A549, U2OS, H1A, H1B, hNPCs, hESCs, fibroblasts, GM12878, MM6, Huh7, Jurkat, CD4T, peripheral-blood, GSC-11, HEK293A-TOA, iSLK, MSC, TIME, endometrial, HEC-1-A, GSCs, NB4, AML
Seq Type List m6A-seq,MeRIP-seq,miCLIP
Transcript ID List ENST00000358771.4,ENST00000622179.4,ENST00000400068.7,ENST00000356025.7
Transcript Detail

Transcript ID Gene ID Gene Name Gene Type Region
ENST00000358771.4ENSG00000198053.11SIRPAprotein_codingutr3-8
ENST00000622179.4ENSG00000198053.11SIRPAprotein_codingutr3-9
ENST00000400068.7ENSG00000198053.11SIRPAprotein_codingutr3-9
ENST00000356025.7ENSG00000198053.11SIRPAprotein_codingutr3-9
Conserved Sites panTro5:m6A_site_36171
snoRNA Num 0 snoRNA Guide Site na
snoRNA Guide Detail na
writer Num 0 Writer Name List na
Writer Catalysis Detail na
PubMed ID

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.

© 2023, Qu Lab. School of Life Science, Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1