| mod ID | m6A_site_530791 | mod Site | chr20:37502119-37502120:- | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
TGGCAGTCCCTCTTCCCAGGACCAGGTGGAGCTGGAGAGAA |
|||||||||||||
| Motif Score | 3.62240476190476 | |||||||||||||||
| RNA Structure Motif |
..........((((..((....))..)))). |
MFE | -8.40 | |||||||||||||
| Support Dataset Num | 14 | Support sub-Dataset Num | 53 | |||||||||||||
| Support Dataset List | ||||||||||||||||
| Support sub-Dataset List |
GSM2739506, GSM2739507, GSM2739522, GSM2739523, GSM2739534, GSM2739535, GSM2991403, GSM2987447, GSM2987448, GSM2987449, GSM928403, GSM908337, GSM1272358, GSM1272360, GSM1272362, GSM1272364, GSM1272366, GSM1272368, GSM1594131, GSM2203060, GSM2283210, GSM2283211, GSM2324292, GSM2324298, GSM2324308, GSM2324310, GSM2332975, GSM2332978, GSM2417477, GSM2417478, GSM2417479, GSM2460347, GSM2460350, GSM2460354, GSM2460358, GSM2754211, GSM2754216, GSM2754222, GSM2754224, GSM2754244, GSM2754246, GSM2754248, GSM2464905, GSM2464907, GSM2464909, GSM2464911, GSM2464913, GSM2464915, GSM2464919, GSM2464921, GSM2464927, GSM2464931, GSM2483505 |
|||||||||||||||
| Cell/Tissue List |
HeLa, HepG2, HEK293T, H1A, H1B, GM12878, Huh7, Jurkat, peripheral-blood, GSC-11, HEK293A-TOA, iSLK, MSC, TIME, endometrial, HEC-1-A, GSCs |
|||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | |||||||||||||||
| Transcript ID List | ENST00000411780.1,ENST00000613961.1 | |||||||||||||||
| Transcript Detail |
|
|||||||||||||||
| Conserved Sites | na | |||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1