RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_532853

mod Site

chr20:44430539-44430540:+

mod Type

m6A

Sequence

GGTAGAGCAGGTGAGATGGGACATTCCAAAGAACAGCCTGA

Motif Score

3.64304761904762

RNA Structure Motif

.....((....((((....))))....))..

MFE

-2.70

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE110320, GSE125240, GSE125803, GSE55572, GSE71154, GSE83438, GSE93911

Support sub-Dataset List

GSM2987447, GSM2987448, GSM2987449, GSE125240, GSM3582052, GSM3582053, GSM3582054, GSM1339425, GSM1339439, GSM1828596, GSM2203043, GSM2203044, GSM2203047, GSM2203051, GSM2203052, GSM2203055, GSM2203056, GSM2203059, GSM2203060, GSM2203063, GSM2203064, GSM2464921, GSM2464931

Cell/Tissue List

HepG2, kidney, liver, A549, Huh7, endometrial, HEC-1-A

Seq Type List

m6A-seq,m6A-REF-seq,MeRIP-seq,m6A-CLIP/IP

Transcript ID List

ENST00000372920.1,ENST00000316099.8,ENST00000619550.4

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000372920.1	ENSG00000101076.16	HNF4A	nonsense_mediated_decay	utr3-11
ENST00000316099.8	ENSG00000101076.16	HNF4A	protein_coding	utr3-10
ENST00000619550.4	ENSG00000101076.16	HNF4A	protein_coding	utr3-11

Conserved Sites

rn6:m6A_site_69382

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

RBM15

Writer Catalysis Detail

Writer Name	Writer ID	Writer Binding Site	Source
RBM15	RBM15:CH51368	chr20:44430522-44430564	SBDH828-13929

PubMed ID

3086759, 31281898, 31597913, 24981863, 26404942, 27773535, 30154548

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.