| mod ID | m6A_site_537641 | mod Site | chr20:56370283-56370284:- | |||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
GCCAGGGACCTCATTTCAAGACTGTTGAAGCATAATCCCAG |
|||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.31938095238095 | |||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
........((((((.....))))))...... |
MFE | -2.40 | |||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 11 | Support sub-Dataset Num | 27 | |||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739522, GSM2991403, GSM3396437, GSM3396438, GSM3582048, GSM928399, GSM928401, GSM1135032, GSM1135033, GSM1339393, GSM1339395, GSM1339401, GSM1339403, GSM1339407, GSM1339425, GSM1339427, GSM1339429, GSM1339439, GSM1982263, GSM2203047, GSM2203051, GSM2283210, GSM2283211, GSM2417477, GSM2417478, GSM2417479, GSM2460347 |
|||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HEK293T, hNPCs, hESCs, fibroblasts, A549, H1299, Huh7, Jurkat, HEK293A-TOA, iSLK |
|||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | |||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000371356.6,ENST00000395913.7,ENST00000395911.5,ENST00000312783.10,ENST00000395915.7,ENST00000395907.5,ENST00000347343.6,ENST00000395914.5 | |||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_371220;panTro5:m6A_site_37737;rheMac8:m6A_site_6991;rn6:m6A_site_70112;susScr11:m6A_site_57763 | |||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1