RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_537661

mod Site

chr20:56392104-56392105:-

mod Type

m6A

Sequence

GGCGGACGAGGACGGCGGGGACAAGGGGCGGCTGGTCGGAG

Motif Score

3.64304761904762

RNA Structure Motif

.......((((.(..........).))))..

MFE

-5.60

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE110320, GSE112795, GSE87516, GSE90914, GSE93911

Support sub-Dataset List

GSM2739506, GSM2739507, GSM2739522, GSM2739523, GSM2739534, GSM2739535, GSM2991400, GSM2991403, GSM2987448, GSM3083805, GSM3083806, GSM3083809, GSM3083810, GSM2332988, GSM2417479, GSM2464927

Cell/Tissue List

HeLa, HepG2, HEK293T, HEK293A-TOA, HEC-1-A

Seq Type List

m6A-seq

Transcript ID List

ENST00000420474.5,ENST00000456249.5,ENST00000395911.5,ENST00000395907.5,ENST00000441357.5,ENST00000312783.10,ENST00000395914.5,ENST00000451915.1,ENST00000422322.5,ENST00000395913.7,ENST00000347343.6,ENST00000395915.7,ENST00000371356.6

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000420474.5	ENSG00000087586.17	AURKA	protein_coding	intron-1
ENST00000456249.5	ENSG00000087586.17	AURKA	protein_coding	utr5-1
ENST00000395911.5	ENSG00000087586.17	AURKA	protein_coding	intron-1
ENST00000395907.5	ENSG00000087586.17	AURKA	protein_coding	intron-1
ENST00000441357.5	ENSG00000087586.17	AURKA	protein_coding	intron-1
ENST00000312783.10	ENSG00000087586.17	AURKA	protein_coding	intron-1
ENST00000395914.5	ENSG00000087586.17	AURKA	protein_coding	intron-1
ENST00000451915.1	ENSG00000087586.17	AURKA	protein_coding	intron-1
ENST00000422322.5	ENSG00000087586.17	AURKA	protein_coding	utr5-1
ENST00000395913.7	ENSG00000087586.17	AURKA	protein_coding	intron-1
ENST00000347343.6	ENSG00000087586.17	AURKA	protein_coding	utr5-1
ENST00000395915.7	ENSG00000087586.17	AURKA	protein_coding	intron-1
ENST00000371356.6	ENSG00000087586.17	AURKA	protein_coding	intron-1

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

METTL3

Writer Catalysis Detail

Writer Name	Writer ID	Writer Binding Site	Source
METTL3	METTL3:CH7782	chr20:56392092-56392150	SBDH174-4541

PubMed ID

29507755, 3086759, 31061416, 27773536, 28525753, 30154548

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.