Details of RNA Modification Site of hg38
mod ID m6A_site_538648 mod Site chr20:58839921-58839922:-
mod Type m6A Sequence ACCTTCCTGACCACTTAAGAACTTTCTAAAGCTCCGCGCCT
Motif Score 3.37338095238095
RNA Structure Motif ........(((.(((....))).))).....
 MFE -1.60
Support Dataset Num 3 Support sub-Dataset Num 9
Support Dataset List GSE52600, GSE87515, GSE94808
Support sub-Dataset List

GSM1272358, GSM1272360, GSM1272362, GSM1272364, GSM1272366, GSM1272368, GSM2332977, GSM2332978, GSM2483505
Cell/Tissue List H1A, H1B, GSC-11, GSCs
Seq Type List m6A-seq
Transcript ID List ENST00000631314.2,ENST00000443966.2,ENST00000424094.6,ENST00000598163.1
Transcript Detail

Transcript ID Gene ID Gene Name Gene Type Region
ENST00000631314.2ENSG00000235590.7GNAS-AS1antisenseintron-1
ENST00000443966.2ENSG00000235590.7GNAS-AS1antisenseexon-1
ENST00000424094.6ENSG00000235590.7GNAS-AS1antisenseintron-4
ENST00000598163.1ENSG00000235590.7GNAS-AS1antisenseintron-2
Conserved Sites mm10:m6A_site_371804
snoRNA Num 0 snoRNA Guide Site na
snoRNA Guide Detail na
writer Num 0 Writer Name List na
Writer Catalysis Detail na
PubMed ID 25456834, 28344040, 28297667

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.

© 2023, Qu Lab. School of Life Science, Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1