Details of RNA Modification Site of hg38
mod ID m6A_site_539891 mod Site chr20:62316277-62316278:-
mod Type m6A Sequence GTTTCATCTGTACAATGGGGACAGCTATGCCTGCAGTGGGA
Motif Score 3.64304761904762
RNA Structure Motif ..(((((..((((......))))...)))))
 MFE -5.90
Support Dataset Num 2 Support sub-Dataset Num 6
Support Dataset List GSE102493, GSE93911
Support sub-Dataset List

GSM2739507, GSM2739534, GSM2739535, GSM2991399, GSM2991400, GSM2464931
Cell/Tissue List HeLa, HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000252999.7,rmsk_5170210,ENST00000471042.1
Transcript Detail

Transcript ID Gene ID Gene Name Gene Type Region
ENST00000252999.7ENSG00000130702.15LAMA5protein_codingintron-57
rmsk_5170210rmsk_5170210MIRcMIRexon
ENST00000471042.1ENSG00000130702.15LAMA5retained_intronexon-1
Conserved Sites na
snoRNA Num 0 snoRNA Guide Site na
snoRNA Guide Detail na
writer Num 1 Writer Name List RBM15
Writer Catalysis Detail

Writer Name Writer ID Writer Binding Site Source
RBM15RBM15:CH52071chr20:62316251-62316287SBDH828-14182
PubMed ID 29507755, 30154548

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.

© 2023, Qu Lab. School of Life Science, Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1