| mod ID | m6A_site_546640 | mod Site | chr21:34888045-34888046:- | |||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
AACTCCCAACAAACCAGAGGACCAGCCACAAACTTAACCAA |
|||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.62240476190476 | |||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
.............((.....))......... |
MFE | -0.40 | |||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 14 | Support sub-Dataset Num | 23 | |||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739502, GSM2739503, GSM2739507, GSM2991403, GSM2884195, GSM2884197, GSM2884199, GSM3582053, GSM908337, GSM1166143, GSM1339439, GSM1908206, GSM2010454, GSM2010456, GSM2203043, GSM2203047, GSM2324298, GSM2417477, GSM2417478, GSM2460347, GSM2460360, GSM2464931, GSM2564019 |
|||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, CD34, A549, HepG2, U2OS, MT4, MM6, Huh7, peripheral-blood, HEK293A-TOA, iSLK, TREX, HEC-1-A, NB4 |
|||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | |||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000475045.6,ENST00000482318.5,ENST00000358356.9,ENST00000344691.8,ENST00000455571.5,ENST00000300305.7,ENST00000437180.5,ENST00000399237.6 | |||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | na | |||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1