| mod ID | m6A_site_548879 | mod Site | chr21:41799576-41799577:- | ||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
TGCAATATATGCCTTCATGAACTAAGGAATGTTCATCCCCA |
||||||||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.37338095238095 | ||||||||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
...........((((((........)))))) |
MFE | -5.10 | ||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 3 | Support sub-Dataset Num | 8 | ||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | GSE102493, GSE90914, GSE93676 | ||||||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739522, GSM2739523, GSM2991403, GSM2417477, GSM2417478, GSM2417479, GSM2754213, GSM2754238 |
||||||||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List | HeLa, HEK293A-TOA, iSLK | ||||||||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | ||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000447016.6,ENST00000398548.5,ENST00000486812.5,ENST00000441787.5,ENST00000449395.5,ENST00000470586.5,ENST00000447207.6,ENST00000422911.5,ENST00000433067.5 | ||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | na | ||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID | 29507755, 28525753, 29109479 |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1