RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_551462

mod Site

chr21:45145974-45145975:+

mod Type

m6A

Sequence

ACGTTCTCACCGAGCTGTGGACTCCTCACTAGGAGCCTTTA

Motif Score

4.06504166666667

RNA Structure Motif

.((((......)))).(((((....))))).

MFE

-7.10

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE120229, GSE125803, GSE37003, GSE55572, GSE65380, GSE83438, GSE90914, GSE93676

Support sub-Dataset List

GSM2739522, GSM2739523, GSM2739535, GSM2991403, GSM3396437, GSM3396438, GSM3582046, GSM3582048, GSM3582049, GSM3582054, GSM908337, GSM1339427, GSM1594131, GSM2203060, GSM2417477, GSM2417479, GSM2460348, GSM2460350, GSM2460354, GSM2460356, GSM2754214, GSM2754216, GSM2754238, GSM2754240, GSM2754244

Cell/Tissue List

HeLa, HEK293T, A549, HepG2, GM12878, Huh7, HEK293A-TOA, iSLK, MSC, TIME

Seq Type List

m6A-seq,MeRIP-seq

Transcript ID List

ENST00000389863.8,ENST00000389861.7,ENST00000496664.5,ENST00000460734.5,ENST00000348831.9,ENST00000629643.2,ENST00000449478.1,ENST00000492414.5,ENST00000437626.5,ENST00000464215.2

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000389863.8	ENSG00000197381.16	ADARB1	protein_coding	intron-2
ENST00000389861.7	ENSG00000197381.16	ADARB1	processed_transcript	intron-3
ENST00000496664.5	ENSG00000197381.16	ADARB1	nonsense_mediated_decay	intron-2
ENST00000460734.5	ENSG00000197381.16	ADARB1	processed_transcript	exon-10
ENST00000348831.9	ENSG00000197381.16	ADARB1	protein_coding	intron-2
ENST00000629643.2	ENSG00000197381.16	ADARB1	protein_coding	intron-1
ENST00000449478.1	ENSG00000197381.16	ADARB1	protein_coding	intron-2
ENST00000492414.5	ENSG00000197381.16	ADARB1	nonsense_mediated_decay	intron-2
ENST00000437626.5	ENSG00000197381.16	ADARB1	protein_coding	intron-2
ENST00000464215.2	ENSG00000197381.16	ADARB1	processed_transcript	intron-2

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

29507755, 31597913, 22575960, 24981863, 25611135, 27773535, 28525753, 29109479

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.