| mod ID | m6A_site_555417 | mod Site | chr22:20110982-20110983:+ | |||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
ATATTTTAGCATTTTGAAAGACTTTCACAGTGAGAGTAGAA |
|||||||||||||||||||||||||||||||||
| Motif Score | 3.31938095238095 | |||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
....((((.(((((...))))).)))).... |
MFE | -3.90 | |||||||||||||||||||||||||||||||||
| Support Dataset Num | 9 | Support sub-Dataset Num | 27 | |||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM3396437, GSM3396438, GSM3582048, GSM3582049, GSM928399, GSM928401, GSM908333, GSM908337, GSM1339393, GSM1339395, GSM1339401, GSM1339407, GSM1339427, GSM1339429, GSM1594131, GSM2417477, GSM2417478, GSM2417479, GSM2460345, GSM2460347, GSM2460348, GSM2460350, GSM2460352, GSM2460356, GSM2460358, GSM2460360, GSM2754248 |
|||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HEK293T, HeLa, HepG2, hNPCs, hESCs, fibroblasts, A549, GM12878, HEK293A-TOA, iSLK, MSC, TIME, TREX |
|||||||||||||||||||||||||||||||||||
| Seq Type List | MeRIP-seq,m6A-seq | |||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000351989.8,ENST00000495826.5,ENST00000383024.6,ENST00000407755.1,ENST00000475941.1,ENST00000498171.5 | |||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||
| Conserved Sites | na | |||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1