RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_55864

mod Site

chr1:154606032-154606033:-

mod Type

m6A

Sequence

CAGCTTGGCAACAGAGCGAGACTCCGTCTCACAAGAAAAAA

Motif Score

3.31938095238095

RNA Structure Motif

..((......))(((((...)))))......

MFE

-6.30

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE107954, GSE125803, GSE29714, GSE37003, GSE46705, GSE48037, GSE74016, GSE76367, GSE85724, GSE87190, GSE90914, GSE93676, GSE93911

Support sub-Dataset List

GSM2739502, GSM2739503, GSM2739523, GSM2739534, GSM2739535, GSM2884195, GSM2884197, GSM2884199, GSM3582053, GSM3582054, GSM928399, GSM908337, GSM1135020, GSM1135021, GSM1135032, GSM1166139, GSM1166141, GSM1908206, GSM1982257, GSM2283210, GSM2283211, GSM2283213, GSM2283214, GSM2283215, GSM2324298, GSM2324308, GSM2324310, GSM2417477, GSM2417479, GSM2460352, GSM2460354, GSM2460356, GSM2460358, GSM2460360, GSM2754214, GSM2754216, GSM2754238, GSM2754240, GSM2464913, GSM2464931

Cell/Tissue List

HeLa, CD34, A549, HEK293T, HepG2, U2OS, MT4, Jurkat, CD4T, peripheral-blood, HEK293A-TOA, MSC, TIME, TREX, iSLK, endometrial, HEC-1-A

Seq Type List

m6A-seq,MeRIP-seq

Transcript ID List

ENST00000471068.2,ENST00000529168.2,ENST00000494866.1,ENST00000649593.1,ENST00000463920.5,ENST00000648231.1,ENST00000647682.1,ENST00000649021.1,ENST00000368471.8,ENST00000368474.9,rmsk_271191,ENST00000647597.1,ENST00000649724.1,ENST00000649042.1,ENST00000648871.1,ENST00000648311.1,ENST00000649749.1

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000471068.2	ENSG00000160710.16	ADAR	processed_transcript	intron-1
ENST00000529168.2	ENSG00000160710.16	ADAR	protein_coding	intron-1
ENST00000494866.1	ENSG00000160710.16	ADAR	processed_transcript	intron-1
ENST00000649593.1	ENSG00000160710.16	ADAR	protein_coding	intron-1
ENST00000463920.5	ENSG00000160710.16	ADAR	retained_intron	intron-1
ENST00000648231.1	ENSG00000160710.16	ADAR	protein_coding	utr5-1
ENST00000647682.1	ENSG00000160710.16	ADAR	retained_intron	intron-1
ENST00000649021.1	ENSG00000160710.16	ADAR	retained_intron	intron-1
ENST00000368471.8	ENSG00000160710.16	ADAR	protein_coding	intron-1
ENST00000368474.9	ENSG00000160710.16	ADAR	protein_coding	intron-1
rmsk_271191	rmsk_271191	AluSc	Alu	exon
ENST00000647597.1	ENSG00000160710.16	ADAR	protein_coding	intron-1
ENST00000649724.1	ENSG00000160710.16	ADAR	protein_coding	intron-1
ENST00000649042.1	ENSG00000160710.16	ADAR	protein_coding	intron-1
ENST00000648871.1	ENSG00000160710.16	ADAR	protein_coding	intron-1
ENST00000648311.1	ENSG00000160710.16	ADAR	protein_coding	intron-1
ENST00000649749.1	ENSG00000160710.16	ADAR	protein_coding	intron-1

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

29507755, 30065315, 31597913, 22608085, 22575960, 24284625, 24209618, 27572442, 27117702, 27371828, 29249359, 28525753, 29109479, 30154548

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.