Details of RNA Modification Site of hg38
mod ID m6A_site_563756 mod Site chr22:35423240-35423241:+
mod Type m6A Sequence GGGCTTCACCAGCCAGGAGGACCAGGAGATGCTGAGCCGCA
Motif Score 3.62240476190476
RNA Structure Motif (((.((.((.((....)).))...)).))).
MFE -3.90
Support Dataset Num 9 Support sub-Dataset Num 19
Support Dataset List
Support sub-Dataset List

GSM2739522, GSM2987447, GSM1908206, GSM2203047, GSM2203059, GSM2283215, GSM2324298, GSM2324310, GSM2332987, GSM2332990, GSM2464905, GSM2464909, GSM2464911, GSM2464913, GSM2464921, GSM2464923, GSM2464927, GSM2564019, GSM2564022
Cell/Tissue List

HeLa, HepG2, MT4, Huh7, CD4T, peripheral-blood, HEK293T, endometrial, HEC-1-A, NB4, MM6
Seq Type List m6A-seq,MeRIP-seq
Transcript ID List ENST00000382011.9,ENST00000216122.9,ENST00000493076.5
Transcript Detail

Transcript ID Gene ID Gene Name Gene Type Region
ENST00000382011.9ENSG00000100297.16MCM5protein_codingcds-15
ENST00000216122.9ENSG00000100297.16MCM5protein_codingcds-16
ENST00000493076.5ENSG00000100297.16MCM5retained_intronexon-9
Conserved Sites mm10:m6A_site_595900
snoRNA Num 0 snoRNA Guide Site na
snoRNA Guide Detail na
writer Num 0 Writer Name List na
Writer Catalysis Detail na
PubMed ID

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.


© 2023, Qu Lab. School of Life Science, Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1