| mod ID | m6A_site_587137 | mod Site | chr3:47122443-47122444:- | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
TAGTAGGTGCAAAGAAAAAGACTTGGATGATACCTGCATGC |
||||||||||||||||||||||||||||
| Motif Score | 3.31938095238095 | ||||||||||||||||||||||||||||||
| RNA Structure Motif |
(((((((((.......)))...)).)))).. |
MFE | -2.40 | ||||||||||||||||||||||||||||
| Support Dataset Num | 16 | Support sub-Dataset Num | 44 | ||||||||||||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739502, GSM2739503, GSM2991403, GSM2991416, GSM2884195, GSM2884197, GSM2884199, GSM3396437, GSM3396438, GSM4024125, GSM4024128, GSM3582048, GSM3582049, GSM928399, GSM928401, GSM908337, GSM1135032, GSM1135033, GSM1339393, GSM1339395, GSM1339401, GSM1339403, GSM1339405, GSM1339407, GSM1339425, GSM1339427, GSM1339429, GSM1339439, GSM1594131, GSM1828596, GSM2010454, GSM2203044, GSM2203060, GSM2203063, GSM2203064, GSM2417477, GSM2417478, GSM2417479, GSM2460345, GSM2460347, GSM2460356, GSM2460360, GSM2460362, GSM2602070 |
||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, CD34, HEK293T, HepG2, hNPCs, hESCs, fibroblasts, A549, GM12878, MM6, Huh7, HEK293A-TOA, iSLK, TIME, TREX, AML |
||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq,DART-seq,m6A-CLIP/IP,miCLIP | ||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000330022.11,ENST00000412450.1,ENST00000445387.5,ENST00000409792.3,ENST00000431180.5 | ||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_649398;panTro5:m6A_site_45774 | ||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1