Details of RNA Modification Site of hg38
mod ID m6A_site_587171 mod Site chr3:47123647-47123648:-
mod Type m6A Sequence CTGATGAAGATTCTGTACGGACTTCTTCAAGTCAAAGATCA
Motif Score 4.06504166666667
RNA Structure Motif (((((.(((....)))..)))))........
 MFE -5.70
Support Dataset Num 6 Support sub-Dataset Num 12
Support Dataset List
Support sub-Dataset List

GSM2739502, GSM2739503, GSM2991416, GSM2884195, GSM2884197, GSM2884199, GSM3396437, GSM3396438, GSM928399, GSM1339393, GSM2203060, GSM2203063
Cell/Tissue List HeLa, CD34, HEK293T, hNPCs, Huh7
Seq Type List m6A-seq,MeRIP-seq
Transcript ID List ENST00000409792.3,ENST00000431180.5,ENST00000330022.11,ENST00000412450.1
Transcript Detail

Transcript ID Gene ID Gene Name Gene Type Region
ENST00000409792.3ENSG00000181555.20SETD2protein_codingcds-3
ENST00000431180.5ENSG00000181555.20SETD2nonsense_mediated_decaycds-1
ENST00000330022.11ENSG00000181555.20SETD2nonsense_mediated_decaycds-1
ENST00000412450.1ENSG00000181555.20SETD2protein_codingcds-3
Conserved Sites mm10:m6A_site_649373
snoRNA Num 0 snoRNA Guide Site na
snoRNA Guide Detail na
writer Num 0 Writer Name List na
Writer Catalysis Detail na
PubMed ID

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.

© 2023, Qu Lab. School of Life Science, Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1