| mod ID | m6A_site_590299 | mod Site | chr3:49278357-49278358:- | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CTGGTTCCTCTGATGGAGGGACACGACCAAGCAGCTCTCAG |
||||||||||||||||||||||||||||
| Motif Score | 3.64304761904762 | ||||||||||||||||||||||||||||||
| RNA Structure Motif |
((((((...))))))................ |
MFE | -5.80 | ||||||||||||||||||||||||||||
| Support Dataset Num | 17 | Support sub-Dataset Num | 56 | ||||||||||||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739506, GSM2739507, GSM2739522, GSM2739523, GSM2739534, GSM2739535, GSM2991403, GSM2884195, GSM2884197, GSM2884199, GSM3396437, GSM3396438, GSM3582048, GSM3582049, GSE129842, GSM928399, GSM928401, GSM928403, GSM908329, GSM908337, GSM1135020, GSM1135021, GSM1135032, GSM1135033, GSM1166139, GSM1166140, GSM1166142, GSM1166143, GSM1339393, GSM1339395, GSM1339401, GSM1339425, GSM1339427, GSM1339439, GSM1594131, GSM2332975, GSM2332977, GSM2417477, GSM2417478, GSM2417479, GSM2460354, GSM2460356, GSM2460358, GSM2460360, GSM2460362, GSM2464905, GSM2464907, GSM2464909, GSM2464911, GSM2464913, GSM2464915, GSM2464917, GSM2464919, GSM2464921, GSM2464931, GSM2564022 |
||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, CD34, HEK293T, hESC-HEK293T, HepG2, U2OS, hNPCs, hESCs, A549, GM12878, GSC-11, HEK293A-TOA, MSC, TIME, TREX, endometrial, HEC-1-A, MM6 |
||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq,MAZTER-seq | ||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000265560.8,ENST00000431357.1,ENST00000351842.8,ENST00000483212.1,ENST00000485450.5 | ||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||
| Conserved Sites | na | ||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1