| mod ID | m6A_site_626974 | mod Site | chr4:1235548-1235549:- | |||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CGGCGAAGCTGATCGGTGGAACTGAGGGGCGGGTTTACCAG |
|||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.37338095238095 | |||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
..(((..(((((...)))))..)))...... |
MFE | -7.60 | |||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 22 | Support sub-Dataset Num | 70 | |||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739502, GSM2739503, GSM2739506, GSM2739507, GSM2739522, GSM2739523, GSM2739534, GSM2739535, GSM2991403, GSM2884199, GSM2987447, GSM3396437, GSM3396438, GSM3582048, GSM928399, GSM928401, GSM928403, GSM908331, GSM908337, GSM1135020, GSM1135021, GSM1135032, GSM1135033, GSM1272358, GSM1272364, GSM1272366, GSM1272368, GSM1339401, GSM1594131, GSM2010454, GSM2010456, GSM2203047, GSM2283212, GSM2324292, GSM2324298, GSM2324308, GSM2324310, GSM2332975, GSM2332977, GSM2332978, GSM2332985, GSM2332987, GSM2332990, GSM2417477, GSM2417478, GSM2417479, GSM2460348, GSM2460350, GSM2460352, GSM2460354, GSM2460356, GSM2460360, GSM2460362, GSM2754216, GSM2754238, GSM2754244, GSM2754248, GSM2464901, GSM2464905, GSM2464907, GSM2464909, GSM2464911, GSM2464913, GSM2464915, GSM2464917, GSM2464919, GSM2464921, GSM2464923, GSM2564019, GSM2564022 |
|||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, CD34, HepG2, HEK293T, H1A, H1B, GM12878, MM6, Huh7, Jurkat, peripheral-blood, GSC-11, HEK293A-TOA, iSLK, MSC, TIME, TREX, endometrial, NB4 |
|||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | |||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000506180.5,ENST00000382952.7,ENST00000515399.5,ENST00000290921.10,ENST00000510568.1,ENST00000514210.5,ENST00000514495.1,ENST00000513420.1 | |||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | na | |||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1