RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_627010

mod Site

chr4:1237504-1237505:-

mod Type

m6A

Sequence

TAAGCCCCATCAGGAGGTGGACACGGGGTTTTCCCTGCACA

Motif Score

3.64304761904762

RNA Structure Motif

.(((((....)))))....((((....))))

MFE

-10.20

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE110320, GSE55572, GSE87190, GSE87516, GSE93911

Support sub-Dataset List

GSM2739502, GSM2739503, GSM2739522, GSM2739523, GSM2739534, GSM2739535, GSM2987447, GSM2987448, GSM1339401, GSM2324298, GSM2324308, GSM2324310, GSM2332985, GSM2332986, GSM2332987, GSM2332988, GSM2332989, GSM2332990, GSM2464911

Cell/Tissue List

HeLa, HepG2, HEK293T, peripheral-blood, endometrial

Seq Type List

m6A-seq

Transcript ID List

ENST00000514495.1,ENST00000513420.1,ENST00000290921.10,ENST00000382952.7,ENST00000506180.5,ENST00000515399.5,ENST00000510568.1,ENST00000515690.1,ENST00000514210.5,ENST00000629223.1

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000514495.1	ENSG00000159692.15	CTBP1	processed_transcript	intron-1
ENST00000513420.1	ENSG00000159692.15	CTBP1	protein_coding	intron-3
ENST00000290921.10	ENSG00000159692.15	CTBP1	protein_coding	intron-2
ENST00000382952.7	ENSG00000159692.15	CTBP1	protein_coding	intron-3
ENST00000506180.5	ENSG00000159692.15	CTBP1	protein_coding	intron-2
ENST00000515399.5	ENSG00000159692.15	CTBP1	protein_coding	intron-3
ENST00000510568.1	ENSG00000159692.15	CTBP1	protein_coding	utr3-2
ENST00000515690.1	ENSG00000159692.15	CTBP1	processed_transcript	intron-2
ENST00000514210.5	ENSG00000159692.15	CTBP1	protein_coding	intron-3
ENST00000629223.1	ENSG00000159692.15	CTBP1	protein_coding	cds-1

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

29507755, 3086759, 24981863, 29249359, 27773536, 30154548

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.