| mod ID | m6A_site_627505 | mod Site | chr4:1740847-1740848:+ | ||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
GAAGTTCAGAAGCAGAAGGAACTTTCCAAAGCTGAAATCCA |
||||||||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.37338095238095 | ||||||||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
.....(((....(((....)))...)))... |
MFE | -4.00 | ||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 8 | Support sub-Dataset Num | 19 | ||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739502, GSM2739503, GSM2987447, GSM1982263, GSM2010456, GSM2203043, GSM2203044, GSM2203047, GSM2203051, GSM2203055, GSM2203056, GSM2203059, GSM2324292, GSM2324298, GSM2324308, GSM2324310, GSM2464921, GSM2564019, GSM2564022 |
||||||||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HepG2, H1299, MM6, Huh7, peripheral-blood, endometrial, NB4 |
||||||||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | ||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000617535.4,ENST00000652770.1,ENST00000651817.1,ENST00000470808.1,ENST00000313288.9,ENST00000612220.4,ENST00000651251.1,ENST00000651472.1,ENST00000404054.3 | ||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_457144;rheMac8:m6A_site_45163;susScr11:m6A_site_128275 | ||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 1 | Writer Name List | RBM15 | ||||||||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail |
|
||||||||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1