Details of RNA Modification Site of hg38
mod ID m6A_site_637858 mod Site chr4:54295450-54295451:+
mod Type m6A Sequence AATGGGATATTTTGAAATGAACTTTGTCAGTGTTGCCTCTT
Motif Score 3.37338095238095
RNA Structure Motif ((((...............))))........
 MFE -0.80
Support Dataset Num 7 Support sub-Dataset Num 19
Support Dataset List
Support sub-Dataset List

GSM3396437, GSM1166139, GSM1166140, GSM1166141, GSM1166144, GSM1339403, GSM2203047, GSM2203051, GSM2203052, GSM2332975, GSM2460352, GSM2460354, GSM2460360, GSM2754220, GSM2754226, GSM2754244, GSM2464907, GSM2464911, GSM2464919
Cell/Tissue List

HEK293T, U2OS, fibroblasts, Huh7, GSC-11, MSC, TREX, endometrial
Seq Type List MeRIP-seq,m6A-seq
Transcript ID List ENST00000257290.10
Transcript Detail

Transcript ID Gene ID Gene Name Gene Type Region
ENST00000257290.10ENSG00000134853.12PDGFRAprotein_codingutr3-23
Conserved Sites mm10:m6A_site_465467
snoRNA Num 0 snoRNA Guide Site na
snoRNA Guide Detail na
writer Num 0 Writer Name List na
Writer Catalysis Detail na
PubMed ID

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.

© 2023, Qu Lab. School of Life Science, Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1