| mod ID | m6A_site_638986 | mod Site | chr4:57065600-57065601:- | ||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
GACGCTAGCTCGGAACTCAGACTGCACGTTTTTGCGGATTG |
||||||||||||||||||
| Motif Score | 3.31938095238095 | ||||||||||||||||||||
| RNA Structure Motif |
..((..(((((...........))))).)). |
MFE | -2.30 | ||||||||||||||||||
| Support Dataset Num | 14 | Support sub-Dataset Num | 44 | ||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||
| Support sub-Dataset List |
GSM2739522, GSM2739523, GSM2739534, GSM2739535, GSM3083805, GSM3083806, GSM3083809, GSM3083810, GSM3582046, GSM3582047, GSM3582052, GSM3582053, GSM3582054, GSM908331, GSM908335, GSM1135020, GSM1135021, GSM1166139, GSM1166143, GSM1982257, GSM2010456, GSM2332975, GSM2332977, GSM2332978, GSM2332988, GSM2460352, GSM2754213, GSM2754214, GSM2754216, GSM2754220, GSM2754238, GSM2754240, GSM2754244, GSM2464905, GSM2464907, GSM2464909, GSM2464911, GSM2464913, GSM2464915, GSM2464921, GSM2464923, GSM2483505, GSM2564019, GSM2564022 |
||||||||||||||||||||
| Cell/Tissue List |
HeLa, A549, HepG2, U2OS, MM6, GSC-11, HEK293T, MSC, iSLK, endometrial, GSCs, NB4 |
||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | ||||||||||||||||||||
| Transcript ID List | ENST00000514062.2,ENST00000512512.3,ENST00000295666.6 | ||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||
| Conserved Sites | na | ||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1