| mod ID | m6A_site_639376 | mod Site | chr4:67731705-67731706:+ | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
GCTTACAAGGGATGTGAAGGACCTCTTCAAGGAGAACTACA |
|||||||||||||
| Motif Score | 3.62240476190476 | |||||||||||||||
| RNA Structure Motif |
.........(((((.....)))))....... |
MFE | -3.60 | |||||||||||||
| Support Dataset Num | 2 | Support sub-Dataset Num | 4 | |||||||||||||
| Support Dataset List | GSE120229, GSE90914 | |||||||||||||||
| Support sub-Dataset List |
GSM3396437, GSM3396438, GSM2417477, GSM2417479 |
|||||||||||||||
| Cell/Tissue List | HEK293T, HEK293A-TOA | |||||||||||||||
| Seq Type List | MeRIP-seq,m6A-seq | |||||||||||||||
| Transcript ID List | rmsk_1336476,ENST00000500538.6 | |||||||||||||||
| Transcript Detail |
|
|||||||||||||||
| Conserved Sites | na | |||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||
| PubMed ID | 28525753 |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1