| mod ID | m6A_site_642195 | mod Site | chr4:82359585-82359586:- | |||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
TACAAAGAAAGATCTGAAGGACTACTTTTCCAAATTTGGTG |
|||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 4.06504166666667 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
.............(((.......)))..... |
MFE | -1.40 | |||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 6 | Support sub-Dataset Num | 15 | |||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2991416, GSM1166139, GSM1166141, GSM1166143, GSM1166144, GSM1908208, GSM2010456, GSM2203043, GSM2203044, GSM2203047, GSM2203051, GSM2203055, GSM2203056, GSM2203059, GSM2602071 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List | HeLa, U2OS, MT4, MM6, Huh7, AML | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq,miCLIP | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000352301.8,ENST00000503822.1,ENST00000509107.1,ENST00000313899.12,ENST00000507010.5,ENST00000515432.1,ENST00000514671.5,ENST00000509263.5,ENST00000353341.8,ENST00000513584.1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_469090;susScr11:m6A_site_132684 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1