| mod ID | m6A_site_643936 | mod Site | chr4:87981650-87981651:+ | |||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CATTCTGATGAATCTGATGAACTGGTCACTGATTTTCCCAC |
|||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.37338095238095 | |||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
....(((((((((......))))..))))). |
MFE | -4.00 | |||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 10 | Support sub-Dataset Num | 29 | |||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2987447, GSM2987448, GSM2987449, GSM3582054, GSM1272358, GSM1272360, GSM1272366, GSM1272368, GSM1339425, GSM1339427, GSM1339429, GSM1339439, GSM1982257, GSM2203056, GSM2203060, GSM2324304, GSM2324306, GSM2460345, GSM2460347, GSM2460348, GSM2460350, GSM2754213, GSM2754237, GSM2754240, GSM2464913, GSM2464919, GSM2464921, GSM2464931, GSM2564019 |
|||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HepG2, A549, H1A, H1B, Huh7, peripheral-blood, iSLK, endometrial, HEC-1-A, NB4 |
|||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | |||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000237623.11,ENST00000509659.5,ENST00000614857.4,ENST00000360804.4,ENST00000508233.5,ENST00000395080.8,ENST00000513981.5,ENST00000509334.5 | |||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | na | |||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1