Details of RNA Modification Site of hg38
mod ID m6A_site_648577 mod Site chr4:118692036-118692037:+
mod Type m6A Sequence CAACATTTTGTAGACACTGGACATAGACCTCAGAATTTCAT
Motif Score 3.64304761904762
RNA Structure Motif (((((.((...(((....)))..))))))).
 MFE -1.60
Support Dataset Num 4 Support sub-Dataset Num 6
Support Dataset List
Support sub-Dataset List

GSM2991416, GSM2987447, GSM2987448, GSM4024125, GSM4024128, GSM2203056
Cell/Tissue List HeLa, HepG2, HEK293T, Huh7
Seq Type List m6A-seq,DART-seq,MeRIP-seq
Transcript ID List ENST00000628452.2,ENST00000388822.10,ENST00000626212.2,ENST00000502564.2
Transcript Detail

Transcript ID Gene ID Gene Name Gene Type Region
ENST00000628452.2ENSG00000145388.15METTL14nonsense_mediated_decayutr3-5
ENST00000388822.10ENSG00000145388.15METTL14protein_codingcds-5
ENST00000626212.2ENSG00000145388.15METTL14nonsense_mediated_decayutr3-5
ENST00000502564.2ENSG00000145388.15METTL14retained_intronexon-2
Conserved Sites na
snoRNA Num 0 snoRNA Guide Site na
snoRNA Guide Detail na
writer Num 0 Writer Name List na
Writer Catalysis Detail na
PubMed ID

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.

© 2023, Qu Lab. School of Life Science, Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1