| mod ID | m6A_site_649832 | mod Site | chr4:123398159-123398160:+ | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CCCCTACTTGTTTTTCTGAGACTTGGGAAGCCTTCCTGAAA |
||||||||||||||||||||||||||||
| Motif Score | 3.31938095238095 | ||||||||||||||||||||||||||||||
| RNA Structure Motif |
....(((((((........)))))))..... |
MFE | -4.70 | ||||||||||||||||||||||||||||
| Support Dataset Num | 13 | Support sub-Dataset Num | 43 | ||||||||||||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739534, GSM2991403, GSM2987449, GSM3396437, GSM3396438, GSM928399, GSM908337, GSM1272358, GSM1272360, GSM1272362, GSM1272364, GSM1272366, GSM1272368, GSM1339393, GSM1339395, GSM1339403, GSM1339439, GSM1828594, GSM2332975, GSM2332978, GSM2417477, GSM2417478, GSM2417479, GSM2460352, GSM2460354, GSM2460356, GSM2460358, GSM2754222, GSM2754224, GSM2754246, GSM2754248, GSM2464905, GSM2464907, GSM2464909, GSM2464911, GSM2464913, GSM2464915, GSM2464917, GSM2464919, GSM2464921, GSM2464923, GSM2464931, GSM2564019 |
||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HepG2, HEK293T, H1A, H1B, hNPCs, hESCs, fibroblasts, A549, CD8T, GSC-11, HEK293A-TOA, MSC, TIME, endometrial, HEC-1-A, NB4 |
||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq,m6A-CLIP/IP | ||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000339241.1,ENST00000505319.5,ENST00000515726.1,ENST00000610581.4,ENST00000651917.1 | ||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||
| Conserved Sites | na | ||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||
| writer Num | 1 | Writer Name List | RBM15B | ||||||||||||||||||||||||||||
| Writer Catalysis Detail |
|
||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1