| mod ID | m6A_site_6528 | mod Site | chr1:10419869-10419870:+ | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
TTTTAAAAGTGTTGTAAGAGACTCCTGAGGAAGACACACAG |
||||||||
| Motif Score | 3.31938095238095 | ||||||||||
| RNA Structure Motif |
..(((.((....)).)))............. |
MFE | -1.80 | ||||||||
| Support Dataset Num | 9 | Support sub-Dataset Num | 27 | ||||||||
| Support Dataset List | |||||||||||
| Support sub-Dataset List |
GSM2884195, GSM2884199, GSM3396437, GSM3396438, GSM4024128, GSM908331, GSM908333, GSM908337, GSM1135020, GSM1135021, GSM1135032, GSM1135033, GSM1339395, GSM1339425, GSM1339429, GSM1982257, GSM2460354, GSM2460356, GSM2460358, GSM2754213, GSM2754214, GSM2754220, GSM2754224, GSM2754238, GSM2754244, GSM2754246, GSM2754248 |
||||||||||
| Cell/Tissue List |
CD34, HEK293T, HepG2, HeLa, hESCs, A549, MSC, TIME, iSLK |
||||||||||
| Seq Type List | m6A-seq,MeRIP-seq,DART-seq | ||||||||||
| Transcript ID List | ENST00000270776.13 | ||||||||||
| Transcript Detail |
|
||||||||||
| Conserved Sites | na | ||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||
| snoRNA Guide Detail | na | ||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||
| Writer Catalysis Detail | na | ||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1