| mod ID | m6A_site_654325 | mod Site | chr4:152411791-152411792:- | |||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CTTTTGGAAATGAATCAGGAACTGCTCTCTGTGGGCAGCAA |
|||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.37338095238095 | |||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
..................((((.....)))) |
MFE | -3.40 | |||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 16 | Support sub-Dataset Num | 47 | |||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739502, GSM2739503, GSM2739506, GSM2739507, GSM2739522, GSM2739523, GSM2739534, GSM2739535, GSM2991403, GSM2884195, GSM2884197, GSM2884199, GSM3396437, GSM3396438, GSM3900734, GSM928399, GSM928401, GSM1135032, GSM1135033, GSM1272366, GSM1272368, GSM1339393, GSM1339395, GSM1339401, GSM1339405, GSM1339427, GSM1339439, GSM1594131, GSM2010454, GSM2010456, GSM2203043, GSM2203047, GSM2203059, GSM2203060, GSM2203064, GSM2283213, GSM2324292, GSM2324298, GSM2324308, GSM2417477, GSM2417478, GSM2417479, GSM2460360, GSM2754211, GSM2754226, GSM2754235, GSM2564019 |
|||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, CD34, HEK293T, BGC823, H1A, H1B, hNPCs, hESCs, fibroblasts, A549, GM12878, MM6, Huh7, Jurkat, peripheral-blood, HEK293A-TOA, TREX, iSLK, NB4 |
|||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | |||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000281708.10,ENST00000647166.1,ENST00000603548.6,ENST00000643834.1,ENST00000603841.1,ENST00000605042.1,ENST00000604872.6,ENST00000642901.1 | |||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_386745;susScr11:m6A_site_130997 | |||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1