| mod ID | m6A_site_661408 | mod Site | chr5:6600167-6600168:- | |||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
GGGGAAAGGCCTCCATTCGAACTTTTGTGCCCAAGAATGAA |
|||||||||||||||||||||||||||||||||
| Motif Score | 3.37338095238095 | |||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
..((((...............).)))..... |
MFE | -2.40 | |||||||||||||||||||||||||||||||||
| Support Dataset Num | 19 | Support sub-Dataset Num | 51 | |||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739506, GSM2739507, GSM2739522, GSM2739523, GSM2739534, GSM2739535, GSM2991403, GSM2884195, GSM2987449, GSM3396437, GSM3396438, GSM3582048, GSM3900734, GSM928399, GSM928401, GSM928403, GSM908331, GSM1135020, GSM1135021, GSM1135032, GSM1135033, GSM1166139, GSM1166140, GSM1166144, GSM1339393, GSM1339403, GSM1339407, GSM1339425, GSM1339427, GSM1339429, GSM1339439, GSM1828594, GSM1828596, GSM1982263, GSM2010454, GSM2010456, GSM2283210, GSM2324292, GSM2324308, GSM2324310, GSM2332975, GSM2464905, GSM2464907, GSM2464909, GSM2464911, GSM2464913, GSM2464915, GSM2464917, GSM2464919, GSM2564019, GSM2564022 |
|||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, CD34, HepG2, HEK293T, BGC823, U2OS, hNPCs, fibroblasts, A549, CD8T, H1299, MM6, Jurkat, peripheral-blood, GSC-11, endometrial, NB4 |
|||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq,m6A-CLIP/IP | |||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000506139.5,ENST00000504374.5,ENST00000264670.11,ENST00000514127.1,ENST00000505892.5,ENST00000513888.5 | |||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_167866;rheMac8:m6A_site_47289;susScr11:m6A_site_53678 | |||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1