| mod ID | m6A_site_677410 | mod Site | chr5:95822642-95822643:- | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CATGGCTCAAGAGTTTGTGAACTGCAAAATCCAGCCTGGGA |
||||||||||||||||||||||||||||
| Motif Score | 3.37338095238095 | ||||||||||||||||||||||||||||||
| RNA Structure Motif |
.....((.(((((.....))))).))..... |
MFE | -2.50 | ||||||||||||||||||||||||||||
| Support Dataset Num | 10 | Support sub-Dataset Num | 29 | ||||||||||||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM3396437, GSM3582046, GSM3582047, GSM3582048, GSM3582049, GSM3582052, GSM3582053, GSM3582054, GSM928399, GSM1135032, GSM1339395, GSM1339403, GSM1339405, GSM1339427, GSM1339429, GSM1339439, GSM1723351, GSM1982257, GSM2283210, GSM2283211, GSM2283213, GSM2283214, GSM2283215, GSM2417477, GSM2417478, GSM2417479, GSM2460354, GSM2460356, GSM2460360 |
||||||||||||||||||||||||||||||
| Cell/Tissue List |
HEK293T, HeLa, A549, hESCs, fibroblasts, LCLs, Jurkat, CD4T, HEK293A-TOA, MSC, TIME, TREX |
||||||||||||||||||||||||||||||
| Seq Type List | MeRIP-seq,m6A-seq | ||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000508780.5,ENST00000512469.2,ENST00000379979.8,ENST00000505427.1,ENST00000237858.11 | ||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_169328 | ||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||
| writer Num | 1 | Writer Name List | RBM15 | ||||||||||||||||||||||||||||
| Writer Catalysis Detail |
|
||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1