RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_679449

mod Site

chr5:111755763-111755764:-

mod Type

m6A

Sequence

AAGATTCTCAAAATGGTAAGACTTGGTCATCAGAGGAGATT

Motif Score

3.31938095238095

RNA Structure Motif

.(((....((((..(((...)))))))))).

MFE

-2.80

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE55572

Support sub-Dataset List

GSM2991403, GSM1339405

Cell/Tissue List

HeLa, fibroblasts

Seq Type List

m6A-seq

Transcript ID List

ENST00000509025.5,ENST00000453526.6,ENST00000505864.5,ENST00000447165.6,ENST00000515855.5,ENST00000509979.5,ENST00000509427.5,ENST00000508161.5,ENST00000395634.7,ENST00000257435.11,ENST00000503429.1,ENST00000507742.5,ENST00000513100.5,ENST00000513684.1,ENST00000508870.5,ENST00000450761.6,ENST00000419114.6,ENST00000507032.2,ENST00000504018.1,ENST00000455559.6,ENST00000446294.6,ENST00000379671.7,ENST00000514515.5

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000509025.5	ENSG00000134986.13	NREP	protein_coding	intron-2
ENST00000453526.6	ENSG00000134986.13	NREP	protein_coding	intron-3
ENST00000505864.5	ENSG00000134986.13	NREP	retained_intron	intron-3
ENST00000447165.6	ENSG00000134986.13	NREP	protein_coding	intron-1
ENST00000515855.5	ENSG00000134986.13	NREP	protein_coding	intron-2
ENST00000509979.5	ENSG00000134986.13	NREP	protein_coding	intron-3
ENST00000509427.5	ENSG00000134986.13	NREP	protein_coding	intron-3
ENST00000508161.5	ENSG00000134986.13	NREP	protein_coding	intron-3
ENST00000395634.7	ENSG00000134986.13	NREP	protein_coding	intron-2
ENST00000257435.11	ENSG00000134986.13	NREP	protein_coding	intron-2
ENST00000503429.1	ENSG00000134986.13	NREP	retained_intron	intron-1
ENST00000507742.5	ENSG00000134986.13	NREP	processed_transcript	intron-1
ENST00000513100.5	ENSG00000134986.13	NREP	protein_coding	intron-3
ENST00000513684.1	ENSG00000134986.13	NREP	retained_intron	exon-2
ENST00000508870.5	ENSG00000134986.13	NREP	protein_coding	intron-3
ENST00000450761.6	ENSG00000134986.13	NREP	protein_coding	intron-2
ENST00000419114.6	ENSG00000134986.13	NREP	protein_coding	intron-3
ENST00000507032.2	ENSG00000134986.13	NREP	protein_coding	intron-3
ENST00000504018.1	ENSG00000134986.13	NREP	retained_intron	intron-1
ENST00000455559.6	ENSG00000134986.13	NREP	protein_coding	intron-3
ENST00000446294.6	ENSG00000134986.13	NREP	protein_coding	intron-3
ENST00000379671.7	ENSG00000134986.13	NREP	protein_coding	intron-3
ENST00000514515.5	ENSG00000134986.13	NREP	nonsense_mediated_decay	intron-2

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

29507755, 24981863

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.