| mod ID | m6A_site_691078 | mod Site | chr5:143222927-143222928:+ | ||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CCCACCTCTCAGTACTTGAGACTTAAAGTGCTACAGGCAGC |
||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.31938095238095 | ||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
.....(((((((........))))))).... |
MFE | -7.10 | ||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 12 | Support sub-Dataset Num | 36 | ||||||||||||||||||||||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2991403, GSM3396437, GSM3396438, GSM3582047, GSM3582052, GSM3582053, GSM3582054, GSM1339395, GSM1339407, GSM1339425, GSM1339427, GSM1339429, GSM1339439, GSM1594131, GSM1828596, GSM2203047, GSM2203060, GSM2324298, GSM2324308, GSM2324310, GSM2417477, GSM2460345, GSM2460347, GSM2460356, GSM2460358, GSM2754211, GSM2754213, GSM2754216, GSM2754222, GSM2754235, GSM2754237, GSM2754238, GSM2754246, GSM2754248, GSM2464931, GSM2602070 |
||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HEK293T, A549, hESCs, fibroblasts, GM12878, Huh7, peripheral-blood, HEK293A-TOA, iSLK, TIME, HEC-1-A, AML |
||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq,m6A-CLIP/IP,miCLIP | ||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000274498.9,ENST00000418236.5,ENST00000443674.5,ENST00000486650.1,ENST00000378004.8,ENST00000642734.1,ENST00000645722.2 | ||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_291102 | ||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1