RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_697318

mod Site

chr5:171391785-171391786:+

mod Type

m6A

Sequence

GGGCCAGTGCATATTAGTGGACAGCACTTAGTAGGTATGTT

Motif Score

3.64304761904762

RNA Structure Motif

...((.((((((((.....))).))))).))

MFE

-4.70

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE37002, GSE55572, GSE83438

Support sub-Dataset List

GSM2739506, GSM2739507, GSM2991416, GSM908331, GSM1339403, GSM1339405, GSM1339407, GSM1339427, GSM2203044, GSM2203047, GSM2203051, GSM2203052, GSM2203055, GSM2203056, GSM2203059, GSM2203063

Cell/Tissue List

HeLa, HepG2, fibroblasts, A549, Huh7

Seq Type List

m6A-seq,MeRIP-seq

Transcript ID List

ENST00000393820.2,ENST00000296930.9,ENST00000517671.5,ENST00000351986.10,ENST00000521672.5,ENST00000518587.1

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000393820.2	ENSG00000181163.13	NPM1	protein_coding	cds-4
ENST00000296930.9	ENSG00000181163.13	NPM1	protein_coding	cds-4
ENST00000517671.5	ENSG00000181163.13	NPM1	protein_coding	cds-5
ENST00000351986.10	ENSG00000181163.13	NPM1	protein_coding	cds-4
ENST00000521672.5	ENSG00000181163.13	NPM1	protein_coding	cds-3
ENST00000518587.1	ENSG00000181163.13	NPM1	retained_intron	exon-4

Conserved Sites

mm10:m6A_site_83200

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

RBM15

Writer Catalysis Detail

Writer Name	Writer ID	Writer Binding Site	Source
RBM15	RBM15:CH66598	chr5:171391778-171391800	SBDH828-17902

PubMed ID

29507755, 22575960, 24981863, 27773535

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.