| mod ID | m6A_site_715148 | mod Site | chr6:36684507-36684508:+ | |||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
GTCCCCAGGTGGACCTGGAGACTCTCAGGGTCGAAAACGGC |
|||||||||||||||||||||||||||||||||
| Motif Score | 3.31938095238095 | |||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
....(.(((((.(((...))).))))).).. |
MFE | -9.60 | |||||||||||||||||||||||||||||||||
| Support Dataset Num | 12 | Support sub-Dataset Num | 47 | |||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739522, GSM2739523, GSM2739534, GSM2739535, GSM2991400, GSM2987447, GSM2987448, GSM2987449, GSM3083805, GSM3083806, GSM3083809, GSM3083810, GSM1272358, GSM1272366, GSM1272368, GSM1982257, GSM2283210, GSM2283213, GSM2283214, GSM2283215, GSM2324298, GSM2324306, GSM2324308, GSM2324310, GSM2332975, GSM2332977, GSM2332978, GSM2332985, GSM2332986, GSM2332988, GSM2332989, GSM2332990, GSM2460358, GSM2464905, GSM2464907, GSM2464909, GSM2464911, GSM2464913, GSM2464915, GSM2464917, GSM2464919, GSM2464921, GSM2464923, GSM2464927, GSM2464931, GSM2564019, GSM2564022 |
|||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HepG2, H1A, H1B, A549, Jurkat, CD4T, peripheral-blood, GSC-11, HEK293T, TIME, endometrial, HEC-1-A, NB4, MM6 |
|||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | |||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000615513.4,ENST00000448526.6,ENST00000405375.5,ENST00000459970.1,ENST00000373711.3,ENST00000244741.9 | |||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||
| Conserved Sites | na | |||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||
| writer Num | 1 | Writer Name List | RBM15 | |||||||||||||||||||||||||||||||||
| Writer Catalysis Detail |
|
|||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1