| mod ID | m6A_site_716311 | mod Site | chr6:41098584-41098585:+ | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
GGTCAGTCACACTGTCCTGGACAGAGTCCAAGTTACCCACT |
||||||||
| Motif Score | 3.64304761904762 | ||||||||||
| RNA Structure Motif |
............(((((...)))))...... |
MFE | -5.10 | ||||||||
| Support Dataset Num | 16 | Support sub-Dataset Num | 36 | ||||||||
| Support Dataset List | |||||||||||
| Support sub-Dataset List |
GSM2739506, GSM2739507, GSM2739522, GSM2739523, GSM2991403, GSM2991416, GSM3396437, GSM3396438, GSM3582054, GSE129842, GSM928399, GSM928401, GSM908337, GSM1135032, GSM1135033, GSM1166139, GSM1166140, GSM1166142, GSM1339393, GSM1594131, GSM1723347, GSM2203052, GSM2203060, GSM2203063, GSM2283212, GSM2324298, GSM2324310, GSM2460345, GSM2460347, GSM2460358, GSM2754213, GSM2754220, GSM2754235, GSM2754237, GSM2754246, GSM2564019 |
||||||||||
| Cell/Tissue List |
HeLa, HEK293T, A549, hESC-HEK293T, HepG2, U2OS, hNPCs, GM12878, LCLs, Huh7, Jurkat, peripheral-blood, iSLK, TIME, MSC, NB4 |
||||||||||
| Seq Type List | m6A-seq,MeRIP-seq,MAZTER-seq | ||||||||||
| Transcript ID List | ENST00000341376.10 | ||||||||||
| Transcript Detail |
|
||||||||||
| Conserved Sites | panTro5:m6A_site_56489;susScr11:m6A_site_122030 | ||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||
| snoRNA Guide Detail | na | ||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||
| Writer Catalysis Detail | na | ||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1